Category: Uncategorized

The Chorale and Church Cantata

Student’s Name

Intuitional Affiliation

The Chorale and Church Cantata

Chorale is a musical piece designed to praise God. It is usually sung in church by a large number of people. Lutheranism had emphasis on the believer-Christ connection. This connection had to be achieved through direct communication; that was to be conducted using vernacular language. Chorales composed in German and easy to sing and remember were harmonized into church choirs.Cantata, on the other hand, was a musical piece composed to reinforce the sermon from a minister who were mainly Epistle and Gospel readings on Sundays and any other Bach holidays. They were long recitations in different movements that included a duet, aria, recitatives, and choruses.

Cantata No. 140: Wachet auf, ruft uns die Stimme, by Bach

Movement I

Four phrases of different lengths make up the first movement. The phrases’ lengths vary between two and five bars. A A B is the form of the chorale and there are three vocal melodies that have been employed to resonate out movement I. The chorale melodies are sopranos that have been doubled by horn.Three voices enter imitatively with note runs that are joyous to paint the word alleluia(01:25) in the first movement. The same scenario is repeated with the phrase Wake up(01:18) The text for this painting is; Wake up and take your lamps.

Movement IV

The chorale melody is carried by the tenor in this movement. The other presentations in this movement are soprano and base. The chorale tunes also have with them a faster rhythmic value in comparison to the other movement discussed above.

Movement VII

The chorale of movement IV has all voices taking part, in contrast to the other movements. The texture of the homophones is simple with four voices that are doubled by the instruments. The instruments do not play their own melodies.

Ev’ry Valley Shall be Exalted, by Handel

There are different word paintings in which rapid musical lines are formed from numerous notes. In the first instance, in the Orchestral section(00:00), phrases are repeated at different dynamic levels at the Instrumental Introduction. The second instance, in the text Ev’ry valley, shall be exalted, there are rapid notes on exalted(00:21). At 00:55, there is a low tone on low in the line And ev’ry mountain and hill made low. The fourth instance has a wavy melody on crooked and a smooth melody on plain(01:01). The text for that painting is; The crooked straight and the rough places plain. Lastly, there are word paintings on exalted, mountain, low, crooked and plain(01:41). These are derived from the text; Ev’ry valley shall be exalted, and ev’ry mountain and hill made low, the crooked straight and the rough places plain.

Hallelujah Chorus

In the chorus, there is as sweeping variety by impulsive changes in the polyphonic, monophonic and homophonic textures. Handel also repeats the phrases and words overly, as has been the ordinary in choral music.

Name of student

Course

Name of the tutor

Institution

The Chosen People

The functionalist perspective of sociology holds that each aspect in society depends on other aspects and plays a role in society’s stability together with its functioning. Any society takes the course that fits it well given the conditions that exist that particular society, and provided that that action helps to preserve the society (Farley and Flota 53). The situations in which different societies exist are very different, for example, the different climatic conditions (Farley and Flota 53).

Emile Durkheim defined a society as a system of interrelated parts (Ferrante 28). According to Ferrante (28), functionalists use the human body, comparing it with society. Similarly, in group action, people join efforts to achieve a certain goal. Just like the human body, the society is made up of many parts, such as schools, laws and norms, sports and religion. Each of these systems plays a role that contributes to the society’s stability. The interdependence of the systems brings the aspect of the principle of interdependency according to Farley and Flota (53). The view was also shared by Comte and Spencer while developing their social theories, which is still more relevant to date since society has become more complex and interdependent. For example, in a school setting, a faculty member is required to teach, and students are needed to learn. However, effective learning depends on several other people and organizations (Farley and Flota 53). All the involved parties must undertake their respective roles and functions effectively in order to achieve the goal of effective learning. The principle of function comes in at this point.

According to Brym and Lie (9), each structure’s function plays a role in the stability of the society at large. Durkheim put it that social stability leads to social order, which, if it lacks, there exists high suicide rates and many strikes from workers (Brym and Lie 9). In line with this, consensus and cooperation principles of this theory are essential. Every society has some values that almost everyone in the society agrees with. For example, most of the Americans agree that they need freedom and democracy, which they all fight for (Farley and Flota 54). People come into consensus in order to achieve cooperation, like in group action, which is necessary for interdependency to be achieved. People cooperate when they feel that they share some things in common, which leads to solidarity. Durkheim viewed social solidarity as the moral cement that binds people together (Brym and Lie 9).

Functionalist theorists also came with the principle of equilibrium, which has it that once a society reaches a form best suited to its situation; it reaches a state of balance. The society remains in that condition, until some other conditions sets in and makes it to change (Farley and Flota 56). Some of the things factors that can distort the equilibrium state include climate change, advancement in the level of technology or the interactions with other societies. The society undergoes some changes that enable it to adapt to the new situations and eventually reach an equilibrium state. Functionalists argued that reestablishing equilibrium could help in solving social problems (Brym and Lie 9).

Merton said that parts of a social system could have dysfunctions, which could either be latent or manifest. Manifest dysfunctions are the anticipated interruptions that occur to order and stability in the society, for example, shortage of clean public toilets and piled garbage (Ferrante 29). Latent dysfunctions are unintended disruptions to order and stability. For example, celebrating excessively which leads to missing classes or work. Any system that is functional today can become dysfunctional in the future, so it is important to consider all aspects when studying any element of the social structure (Farley and Flota 56).

Works cited

Brym, Robert and Lie, John. Sociology: Your compass for a new world, brief edition: Enhanced edition. Boston: Cengage Learning, 2009. Print.

Farley, John and Flota, Michael. Sociology, sixth edition. Boulder: Paradigm Publishers, 2011. Print.

Ferrante, Joan. Sociology: A global perspective, enhanced. Boston: Cengage Learning, 2010. Print.

A New Education Law

Student’s Name

Institution Affiliation

Course Name and Code

Professor’s Name

Date

A New Education Law

The chosen school law is the Every Student Succeed Act (ESSA). The ESSA bill was introduced to the senate on April 30, 2015, by Lamar Alexander. On December 10, 2015, the bill was signed into law by President Barack Obama. The ESSA was intended to update and replace the No Child Left Behind Act (NCLB), which was signed into law by President George W. Bush on January 8, 2002. Although NCLB was revised in 2007, its prescriptive requisites became more unworkable for educators and schools with time. With this in mind, the Obama administration in 2010 collaborated with educators and families to establish better legislation to ensure that each student is sufficiently prepared for success in college and careers. This new legislation was ESSA. The ESSA did not do away provisions that relate to the periodic standardized evaluations given to students. Also, the ESSA represents good news for schools in the country as it builds on significant areas of progress in modern days made possible by the efforts of communities, educators, students, and parents across the nation (US Department of Education n.d).

The ESSA has had significant impacts on public schools today. Firstly, the law has clear expectations from the education Stakeholders where states are required to engage in and provide evidence that is based on facts and consultations with a variety of other stakeholders in making major state-level decisions (Adler-Greene, 2019). This today has resulted in the unity and collaborations of education stakeholders from Principals, teachers, and support persons to other staff in providing quality education. The law has been of great benefit in that it has put states and school districts in charge. With it, there are new opportunities and flexibility, which enables the states to balance many decisions. Among the decisions allowed are that the states are permitted to design their school ratings and choose the criteria for determining the lowest performing rates. Consequently, this has led to an increase in the number of high school graduates. This has been translated to an increase in the number of students joining public colleges than before.

Also, With ESSA, public schools have been able to get more funds to finance school activities. This has been achieved through ESSA’s extended flexibility for funds that are invested in technical and career education as well as money directed towards transportation for students attending higher-performing schools (Office of Elementary & Secondary Education, 2020). The funds have helped in increasing the capacity of schools, states, and local communities. This has benefited all learners to have accessibility to a well-rounded learning and improved learning environment. Under the new budget, ESSA is funded at $17.5 billion for 2022 financial year, an increase above $ 1 billion in 2021 financial year. The funds have been utilized to improve accessibility to better school psychological services and improve public school safety (Aragon et al., 2016). Overall, with the impacts stated above, it can be inferred that ESSA provides a strong basis to expand educational opportunities and improve educational outcomes

References

Adler-Greene, L. (2019). Every Student Succeeds Act: Are schools making sure every student succeeds? Touro L. Rev., 35, 11.

Aragon, S., Griffith, M., Wixom, M. A., Woods, J., & Workman, E. (2016). ESSA: Quick Guides on Top Issues. Education Commission of the States.

Hess, F. M., & Eden, M. (Eds.). (2021). Every Student Succeeds Act (ESSA): What it means for schools, systems, and states. Harvard Education Press.

Office of Elementary & Secondary Education. (2022). What is the Every Student Succeeds Act? Retrieved 5 October 2020, from https://oese.ed.gov/families/essa/.

U.S. Department of Education. (n.d.). What is ESEA? Retrieved from http://blog.ed.gov/2015/04/what-is-esea/

The Chosen-by Rabbi Chaim Potok

Student

Institution

Introduction

In his work, Pokot expresses the existing tension between traditional Judaism and the modernity in America. The title ‘Chosen’ resonates well with the incidences which occur in the story. In a broader way, Pokot balances stand on fusing both modernity and traditional practices. The narration does not indicate author’s tendency of taking side in the religious matters.

The predominant characters in the story are Hasid and Orthodox Jews. Hasid demonstrates staunch religious belief to facilitating loyalty and faithfulness in devolving the spiritual knowledge whereas Orthodox demonstrates rationality in fusing the traditional and the modern ways of live, thus encouraging fullness and comfort in the devolved environment. The author applies parallel views of the characters to demonstrate both similarities and differences in spiritual, social and political grounds.

Major Themes

Conflict

The story demonstrates conflict between American modernity and the Hasidism traditions. Danny and Reuven’s are imaginative and willing to adopt new modes of life despite being activists of Hasidism. However, they seem are alienated from the development of the story, which is evident during David Malter’s public speech at the Madison Square Garden. Reuven, who participates in ensuring devolvement in secularism, does not attend the meeting.

The enmity in the story is attributed to two philosophies in the Jewish community: David Malter’s understandings of the world and Reb Saunders’s ignorance and isolationist fanaticism. The latter has a stubborn mindset, limiting him from seeing the outside world. Conversely, David Malter is eager to adopt modernity through systematic transformation from the traditional ways of life. It is not a surprise for ever-silent Reb to express his desire of Danny being ‘tzaddik’. His mind is tone by religion and spirituality.

Parallelism and its significant

Pokot applies both complements and contrasts to reveal the fullness of life through constructive fusing of the persistent religion differences. He underlines the importance of relationships in enhancing reflection of our image, thus encouraging both positive and negative responses. For instance, the friendship shared by Reuvan and Danny is parallel. Reuvans trains Danny to be open-minded and patience, whereas Danny coaches Reuvan on methods of studying Talmud.

Similarly, Pokot applies parallelism to contrast between roles taken by individuals. For example, both Reb Saunders and David Malter are highlighted as fathers and religious fanatics but they share different opinions on religious matters. Parallel roles between Rav Gershenson and Malter are evident where the former mentors Reuven in absence of Malter.

Characters

Reuven Malter

He denotes the struggle between the traditional customs and the possible modernity in the people’s ways of life. The author uses him as distant observer of the commotion that exists in Danny’s attempts to defend his personal views. Even though the narration revolves Danny as the main character, Reuven is used by the author to highlight how effectiveness of true friendship Moreover, Reuven promotes Danny’s transformation into Hasidism. His concern on the tribulation of his society mounts to pity and empathy. He consoles adamant individuals on the importance of maintaining their culture. Still, his relation with Danny suggests on the importance of unison and loyalty in reviving haunted hope.

Danny Saunders

Danny is the instrument of conflict in the story. Chapter one starts with the description of Danny’s confusion on the side to submit to, either his traditional upbringing or the modernity. He tries to convict himself of the weaknesses associated with his traditional customs, grappling into the idea of opposing his father’s wishes. He holds similar characters with Reuvan, who has been used to construct a better future for Danny. Both of them are quick thinkers, good learners and hold similar perceptions on Jewish faith. This makes it essay to exchange views, widening their perspectives. They inherit both positive and negative ideas from one another.

Danny is retrospective of the agendas and views articulated in the book ‘Graetz’s History of Jews.’ This generates prior ill views which his father attempted to instill on him. Malicious and destructive claims on Hasidism add misery to his long perceived unity and resolution between the traditional and modern ways of life. After sharing his mind with Reuven, he takes a back fiddle in ideological argument with his father. Later on, he resolves with his father, focused to inherit his position after his tenure of leadership. The society accords the two with appropriate supports to enhance comfortable and fulfilling leadership.

David Malter

He is a one dimensional character with good intellectual and religion rigor. He represents American Jews who are neutrals to both traditional ways of life and Hasidism. His education capacity plays essential role in enabling him to intermarry lifestyles, thus demonstrating respect and love to both conservatists and defectors. Moreover, David Malter has a clear understanding of the contribution of reciprocity and relationships in bringing harmony between the traditional and secular maniacs.

In chapter 13, David Malter argues that, “man must fill his life with meaning, which is not an assurance given to life”. His personality is temporal. For instance, he changes from gentle father to Zionist campaigner. This happens after he discovers the Holocaust. He perceives the effective way of creating meaning to Holocaust by mobilizing Jews to restore their ancestral land, Israel. Comparatively, he does not downplay the importance of religion in encouraging political growth, unlike Reb’s perceptions.

Reb Saunder

He is presented as indecisive and unpredictable character. He possesses cruelty towards his own son, disapproved selfishness in success and achievements of others, and a threat to his detractors. His insincerity is portrayed by refusal to share chat with his son. He is inhuman for expressing his fury towards his son’s friendship with Danny and Reuven. More to this, it is beyond imagination of his attempts to push Danny battle for leadership with his father. If Reb designed his moves well, it would be easy to mobilize Danny to sabotage his father’s plans of creating transformative leadership.

Reuven feels that humiliation of Danny’s father at the hands of his own son would make Reb happy. However, this is a wrong imagination. Surprisingly, the truth unravels in the final chapter where Reb’s silence is intended to make Reuven befriend Danny in bid to sustain him in the leadership. Reb’s willingness to allocate Reuvan an opportunity to express his views regarding his father indicates love and care for his son. He neither expresses embarrassment nor bitterness at his son’s reaction. Rebs is emotional, indicating humanity and empathy towards others.

Notably, Reb is complex since his all-tie mission is evidenced at the final chapter. It appeared obvious that he would be outrageous with Danny’s failure of being Rabii but this does not happen. Actually, his motive was to teach Reuvan to treat others with compassion through understanding the cost paid in their achievements. This is nothing more than being complicated. It is intriguing in his claims that he lacked significant means of expressing his actual feeling towards the Hasidic tradition. In fact, his role indicates the impacts of fanatism, self-centeredness and isolationist behavior.

Name

Professor

Course

Date

The Christian Paradox

In the “The Christian Paradox: How a faithful nation gets Jesus wrong” by Bill McKibben ,shows that a country such as America, which seems to pride itself on following the Christian faith has little real understanding in terms of the religion, which they claim to follow. He insists that they actions and behavior do not follow any Christian teaching as they have their own deals and follow a creed, which is in contrast to the Christian religion. It is evident that a creed, which is preached by majority of televangelists together with preachers, tends to demonstrate the aspect. The creed is mainly centralized on the notion that God tend to help individuals who try to help themselves, which is definitely a conception that could not be more in contrast to Christianity basic ideas. This is because the notion that God only help those who help themselves remains the core of many Americans behavior.

The year, 2004 saw a statistic provided by McKibben showed America ranked second last in government provision of provided foreign aid n terms of economic earnings as private charities tend to increase the amount by a small percentage. At the same time, Aid to given to their own citizens is not any different. America trails in almost every category for example almost eighteen percent of children in American children live below the poverty line in comparison to Sweden’s, which is a secular nation and is eight percent. Conversely, the numbers seems not be improving in that according to the American Department of Agriculture, which McKibben cites, houses number which were experiencing food insecurity was on the rise compared to twenty six percent in 1999 to 2003. In spite of the biblical teaching on loving one’s neighbor’, that is not the case in a tremendously Christian America.

McKibben argues that Christianity in America presently seems to forgo the foundation of Christian teachings in the Bible, and replacing it with the latest interpretations complete with fabrications, which seems to support a new, egotistic form of Christianity. At the same time, only around 40percent of Americans are comfortable naming four or even more than four in relation to the Ten commandments with only scant half being able to cite the Gospels four authors. The failure to be in a position to recall certain specifics Christian heritage is the evidence of the country’s educational decline. However is obviously does not matter in terms of political or spiritual matter. It is obvious that as a Christian nation, it has to mean something as individuals who attend church absorb the lessons learnt there and make logical decisions in relation to the lessons. The lessons often inform their politics as one poll showed that 11 percent of churchgoers in America were encouraged by their clergy to vote for one particular political block.

George Bush often say that Jesus Christ happens to be one of his favorite philosopher, although he might not or be sincere, he seems to reflect the genuine beliefs of the most Americans majority. There lies the paradox as America remains the most professedly Christian in relation to developed nations but has the least Christian behavior in terms of most citizens actions. It is true that around 75 percent of Americans claim to pray to God daily, but only a 33 percent state they manage to attend church weekly. Still, although, 85 percent overemphasize actual practice, this clearly symbolizes aspiration. There is nothing else, which tends to unite over four fifths of America. This is because other statistic, which a person can cite on American behavior, is essentially a measure of the professed Christians behavior. The country is a place saturated in terms of Christian’s identity, which begs the question on whether it is a Christian nation. Christ was specific on what He wanted for his followers. Maybe the simple criterion is giving help to the poorest people being a sensible substitute for Christian behavior.

Nevertheless, the days prior to crucifixion, when Jesus summarized his message to his disciples was that the separation of the righteous from the immoral was on their actions. This involved welcoming the stranger, feeding, and the hungry, clothing the naked, and visiting the prisoner. Ironically, the country was ranked second last in the year 2004, after Italy, in developed countries in giving out government foreign help. This means each citizen offer fifteen cents daily in official development aid to underprivileged countries. On the other hand, they are not giving private charities in relief work as a substitute. Such funding tends to increase the country’s average daily donation to twenty cents. At the same time, around 18 percent of children in America live in abject poverty. In fact, preschool access, childhood nutrition, and infant mortality the country is ranked almost last among the affluent nations with a wide margin. It is evident that that the American country trails badly in Christian teachings, which Jesus seemed to pay attention.

It is evident that the American Christian nation seems to make individual contrary to political, choices, which the Bible would be viewed to oppose. In spite of the Sixth Commandment, the nation remains the most vicious rich nation in the world with the rate of murder being four that of their European peers. The population in prisons is greater six times in comparison to other rich nations, which also should give plenty of opportunity in terms of prisons visits. America is the only Western democracy left, which execute its people, generally in the states where Christianity remains in theory strongest. In spite of Jesus’ strict declarations on divorce, marriages tend to break up at a speedy rate compares poorly with the countries found in the European Union’s average. The country tops the charts in terms of teenage pregnancy, obesity, credit purchase, which definitely prove that Americans are hypocrites.

The more disturbing explanation for this detachment remains between belief and action. This is because many Americans, which seem to means mainly believers, have replaced Bible Christianity, with its call for profound sharing as well as individual sacrifice; with an opposing creed. Many American churches seem to have done a good job in loving their neighbor, when they are in church. This means majority of them are Sunday Christians and do not practice Christianity practically but in theory. It is obvious that many churches concentrate on consumer gospel in many suburban megachurches, which remains a perfect match for development of conservative financial notions. The situation entails personal accountability instead of a joint action. This does not entail privatization of Social Security, which makes health care expensive and claim that God only helps those who try to help themselves.

The CIA Framework

Confidentiality, integrity and availability, components of the CIA framework, is a structure and model used to provide guidance on policies for organizational information security. Confidentiality denotes the guidelines or rules limiting access to information. Integrity provides assurances that information available is accurate and trustworthy. Lastly, availability is the guarantee of reliability of access to organizational information by authorized parties.

Confidentiality

The process through which an organization strives to keep its data private or out of the public eye is known as confidentiality. In practice, it entails putting access controls on data in order to prevent illicit disclosure of the information. In most cases, this means taking precautions to ensure that only those who have been granted the appropriate authority may access certain resources and that unauthorized individuals are actively prevented from having access to these resources. For example, the database containing employee payroll information should only be available to authorized Payroll staff members. In addition, within a set of authorized users, there may be further constraints that are more stringent on the particular information to which authorized users are granted access.

In September of 2016, Yahoo disclosed some of the first information of a large data breach. Late in 2014, the business disclosed that hackers had gained unauthorized access to the personal information of 500 million individuals (Trautman & Ormerod, 2016). There was a total of eight million accounts in the United Kingdom that were distributed to various third parties after being auctioned off. Yahoo was aware of the breach, but at the time, the company was unaware of the full extent of the leak’s implications. While looking into a different data breach in July 2016, the company made the startling discovery that the user account information of more than 200 million of its customers was being offered for sale on a website that served as a darknet market.

Integrity

The capacity of anything to fulfill or satisfy all of its demands is referred to as its integrity. “Integrity” in the context of information security refers to the process of validating that data has not been changed and is hence trustworthy. Integrity denotes that information provided is truthful, trustworthy, and accurate. For example, when making an order, online shoppers want product and pricing information to be correct, as well as all other information, such as quantity, price, and availability, to be consistent. Customers of financial and e-commerce services must have confidence that their personal information and account balances will be kept confidential. Integrity assurance protects data whether it is utilized, transferred, and stored, whether on a personal computer or a portable storage device such as a tablet, whether in data centers, or in the electronic or cloud platforms. 

Enron utilized accounting mistakes to disguise bad debt and inflate earnings in 2001. As Enron’s value collapsed, investors lost billions in investments (Eckhaus & Sheaffer, 2018). Enron executives misused their power and privilege, fabricated papers, treated internal and external constituents unjustly, placed their personal interests ahead of employees and the public, and failed to exercise effective supervision or take responsibility for unethical conduct. Enron’s internal and external connections were inconsistent. Ordinary employees were compelled to buy in Enron stock and then barred from selling when the price fell.

Availability

If an organization’s systems, programs, and data are not accessible when needed by authorized users, then both the business and its clients will get little benefit from them. The operational and active states of networks, systems, and applications are simply referred to as being available. It guarantees that whenever they are needed, authorized users will have prompt and dependable access to these resources. Availability may be compromised by a variety of things, including errors made by humans, faulty hardware or software, power outages, and natural disasters. One of the most frequent types of assaults that jeopardize a system’s availability is the denial-of-service attack. A system, website, online application, or web service may be purposefully and maliciously compromised in this kind of assault, or the system may become entirely unreachable.

Wells Fargo was the victim of many serious distributed denial-of-service attacks in 2012. Wells Fargo customers reported being unable to access the bank’s website, mobile apps, and other critical channels for accessing personal and financial information (Alsadhan et al., 2022). The denial-of-service attack caused server failures, resulting in financial losses and a great deal of stress for the organization’s professionals working to restore offline resources.

References

Alsadhan, A., Hussain, A., Liatsis, P., Alani, M., Tawfik, H., Kendrick, P., & Francis, H. (2022). Locally weighted classifiers for detection of neighbor discovery protocol distributed denial‐of‐service and replayed attacks. Transactions on Emerging Telecommunications Technologies, 33(3), e3700.

Eckhaus, E., & Sheaffer, Z. (2018). Managerial hubris detection: the case of Enron. Risk Management, 20(4), 304-325.

Trautman, L. J., & Ormerod, P. C. (2016). Corporate directors’ and officers’ cybersecurity standard of care: The Yahoo data breach. Am. UL Rev., 66, 1231.

The Civil War

Name

Course

Date

In the mid-19th century, the Norther and Southern America started conflicting and there was a tension between these two regions. The states started seceding while the union was separating. The Northern part was equipped with industries and factories while the people of the South specialized in farming and utilised slaves to work in these farms (Stampp, K. M. (Ed.). 1986). The two sides started drifting and alienating each other and within a short period they ended up in a war that was called the Civil War. Abraham Lincoln was the president then and he thought the war would not las more than three months but the war took years before coming to an end.

Among the causes of civil war was slavery where the North were against slavery while the South depended on slaves as a source of labour. Slavery was the central conflict that led to other reasons that further divided the two sides. First the north viewed slavery as immoral act by the Southern Whites where these slaves had rights too. The Northern region thus discouraged the south from enslaving the people of colour. The South was not willing to free the slaves who were over 350,000 in number (Stampp, K. M. (Ed.). (1986). The South wanted to expand their territory of slavery to the North but this was in vain since the Western territories of the North were strictly hiring white labour and not at any point were they for the idea of hiring the blacks in the name of cheap labour.

There were federal laws in place which were against the idea of slavery, due to this the South wanted to forcefully take authority from the federal government where they would then put an end to the laws that undermined slavery. The Republican party was formed where the members were strongly against slavery and the expansion of slave labour into the west. The republican party started gaining members and in 1861 Abraham Lincoln was nominated to vie for presidency. Without a single vote from the South Lincoln managed to win which made the south realize that power was no longer on their side and Lincoln was going to fight had to see slavery was abolished (Stampp, K. M. (Ed.). (1986). Since the South no longer had influence on the North and felt excluded from the regions political system they decide to secede which then led to the two regions going into war.

The bloody war between the South and the North came to an end in May 1965 where the North won. The North won the war because of several reasons, where first it was well established with industries which produced fire arms and iron which was used in fighting the war. The North also gained support from other countries which felt slavery was depriving the back people their rights. One major contribute g factor to the north winning the war was the larger population of over 22 million people thus could get people to recruit into their army and navy to fight the war (Hattaway, H., & Jones, A. 1991). The navy and the army was well equipped with weapons.

The South who majorly depended on farming hoped that France and Britain would purchase their cotton to help them get funds to purchase weapons but this did not happen since these countries had their own cotton. Many Blacks latter escaped to the North and were recruited in the Northern army also did gave the North more strength and chances of winning against the south (Hattaway, H., & Jones, A. 1991). The North fought tirelessly which saw the south make different strategies and their armies surrendering one after the other. In April 9th 1865 the Lee’s confederate army was the last to surrender which left the South with no option than to give up and the North won the war.

The blacks’ participation in the war led to the economic position improving however this did not last longer. The African Americans were freed from slavery and to add on this they were allowed to vote in any democratic events including elections. Also the economic situation of the blacks improved whereby they had received some money as a result of participating in the Northern army (Foner, E. 1987). During the emancipation period the blacks took the advantage and went to the class to learn and as a result of being literate they were able to later acquire better jobs than slavery which improved their living standards.

However, the idea of White supremacy in the south did not come to an end. After the end of civil war despite Lincolns efforts to end slavery and oppression of the black race in the South the whites did retain their supremacy through reconstruction. In this period the White formed political groups that they could be identified with and oppressed the blacks. The went ahead and formed laws that codified inequality. These groups used violence to oppress and intimidate the black community and by 1877 at the end of reconstruction the White supremacy was known and the blacks continued to be submissive to the whites’ ideologies since they were inferior.

In conclusion from the idea of white supremacy we can conclude that the Civil War helped to end slavery but racism would continue afterwards. The Whites in the South discriminated against the blacks and made them feel inferior in any way possible due to bitterness after having lost on the idea of slavery.

References

Foner, E. (1987). Rights and the Constitution in Black Life during the Civil War and Reconstruction. The Journal of American History, 74(3), 863-883.

Hattaway, H., & Jones, A. (1991). How the North Won: A Military History of the Civil War. University of Illinois Press.

Stampp, K. M. (Ed.). (1986). The Causes of the Civil War. Touchstone.

RUNNING HEAD: VIOLENCE IN SOUTH UNITED STATES

The Claims on the Subculture of Violence in the Southern part of United States

Name:

Course:

Tutor:

Date:

 

The Claims on the Subculture of Violence in the Southern part of United States

Introduction

In different parts of the world there exist disputes which may at times lead to constant warring between the parties involved. These may either be inter or intra border or community. The causes of such wars are at times obvious as they could be religious, cultural or political. However due to the duration taken by the conflicts it may be difficult to ascertain their exact cause leading to a number of ideas by different interest groups or individuals. This is the case presented by the war in the south of United States for a number of centuries that has elicited various thoughts on the causes. Some of the authors involved are Richard Nisbett and Dov Cohen who present a different argument in their book from that of Goffman. With this regard the paper will look at both arguments comparing them with each other.

There has always been war in the form of homicide in the southern part of United States of America. The rate of these wars has been consistently higher than that experienced in the northern parts. The argument created by Nisbett and Cohen provides the starting point to understand the major causes of the violence. They brilliantly bring out how various cultures, economics and behavior elicited by individuals interact. They use all the tools of social science by combining both theoretical and methodology which incorporates survey which involves the comparison of the south to other areas, research from the archives which provides sufficient information on what other people have discovered and laboratory experiments to act as a test for their thesis (1996).

According to them, the white southerners to not engage in violence due to their socioeconomic class, density of their population, the legacy they associate with slavery or the heat found in the south as many may speculate from their description. Rather they do this due to the important role that traditional culture plays in the region. It is referred to as a culture of honor where one’s reputation determined by his personal strength and not character largely determines his survival in the economic field along credibility socially. They are therefore expected to revenge in the event that their honor or defense capability is insulted and therefore violence based on the approach that a person becomes right due to his might. From an early stage in life, young men are prepared for these violent activities by becoming aggressive to guard their honor and be actively defensive. This culture was inherited from the initial dominating occupants of the south: the Scott-Irish who mainly herded from Scotland’s and Northern Ireland’s mountainous regions (Nisbett & Cohen, 1996). This group of people is known to be more violent than farmers, hunters and gatherers since they are more prone of losing their portable herds to others. The remote population in the region as well as its geographical positioning also contributed significantly to the wars. At times, this is caused by the lack of proper government that led them to defy the regulatory law hence a lot of stealing in order to acquire wealth. Normally the violence is used as a way to provide protection to the home and property as well as offer children the ability to socialize and therefore it is allowed in the south as a response to an insult. The central beliefs practiced by these communities may as presented by Nisbett and Cohen have led to the increase of violence in the south in future. Additionally, from experiments and social policy this is reflected in the way the southerners speak, take part in their institutional practices, act and respond physiologically to any known confrontation.

From their data, it is clear that the homicide rates in the south is greater than those in the north and especially in small towns as opposed to the big cities due to the influence that culture plays. In addition the arguments normally thought to threaten the control of both men and women in the south also contributes greatly to the violence. As a result it is regarded as being on the darker side for the high violence levels despite the gentility, close family ties, leisure and warmth associated with the region. It contributes to a negative heritage related to the environmental attitudes such as corruption, the traditional political culture and subsequent annual high rates of murder and low quality of life. Despite this fact, as compared to other parts the southerners support more reasons for violence such as the achievement of change socially. They also provide evidence against obvious consequences of war like inequality of income and slavery by relating the same to the cooler mountain areas where slavery was rarely practiced. The southerners’ engagement in violence has nonetheless led to their known success as soldiers and expertise in military activities (Nisbett & Cohen, 1996).

These views are similar to those expressed by Goffman (1999) who presents the basic goal of people who interact with others to be the acceptance of the way they present themselves by others. He uses theater imagery by relating performance and front to real life situations. This serves as an attempt to explain why people take part in their different social actions. In relation to this, the southerners with their beliefs expect even their observers to believe that the outcome of this violence is the actual one intended. They do this by creating the belief that their honor will be maintained and the ideas started by their ancient ancestors accomplished which results to them being taken in by their actions at such times making it real even to those observing. Since they are out to show their capabilities, they do this for other people which are portrayed by the aggressiveness exhibited by the southerners. This is additionally made possible by the knowledge that everyone in the region approves of these activities. They may also be violent as a way to express themselves.

The southerners have however adapted to their live despite the regulatory laws. This relates to the situation of the couple owning the tourist hotel in Shetland as portrayed by Goffman. With time, one gives up showcasing opting to perform activities in relation to their own beliefs and traditions as is the case in the south. This leads to the occasional transitions between cynicism and truthfulness in the actions that people indulge in. additionally, the denial by the southerners on the implications of the war relates well to the implication management illustrated by Goffman to show that nothing is wrong in the way they follow their violent traditions. They also involve themselves in the homicides in order to prove their socio-economic status to foreigners and strangers who can define the situation in this area as they are expected to regard them highly. The knowledge of the early inhabitants of the area as is described by Nisbett and Cohen plays a great role in helping foreigners understand the kind of people living in the region as well as their supposed activities (1999).

There are a number of reasons that make people take part in their various activities. In relation to the violence experienced in the Southern part there may be the need to create an impression upon foreigners besides the cultural traditions of the people. In conclusion therefore there may be more than one reason as to why the war takes place and also why it will still continue in future.

References

Goffman, E. (1999). The Presentation of Self in Everyday Life. New York:Peter Smith Publishers

Inc.

Nisbett, R., & Cohen, D. (1996). Culture of honor: the psychology of violence in the south.

Boulder, Colorado: Westview Press.

Literature

Students Name

Institution of Affiliation

Course Title

Date

The claims that entertainment has the capacity of ruining the society is often indicative of the weak grasp of the people who critique entertainment possess the society’s primary fundamentals. Entertainment is only able of demolishing the society’s structure if its audiences’ foundations tend to lose such that they would fear its destruction on a piece of literature, film or the countless other forms of audience satisfaction. It is obvious that entertainment holds insurmountable weight in the society, but it does not possess the capacity to ruin it or cause its downfall but does, however, have the ability to change the society due to the varying definitions of the word ‘ruin.’

The entertainment is capable of introducing dramatic change, and there are some of the people who tend to view even the most straightforward changes to the society as it ruins such as the 19th-century aristocrats. Wealthy men and women were abundant in the 19th century, but wealth couldn’t equate power, thus eliminating the wealthy women from the social hierarchy and giving an advantage to the wealthy white men. When the women became more prominent in the field of entertainment, it began threatening the domination of men in the western culture. The authors Flannery O’Connor among others paved the way for the females’ entertainment, and in the public view, they slowly stimulated the changing perspective of women in the society. Women in the prominent roles outside of the homes are more common in the settings of the 21st century but too many is regarded as the definition of ruining the society.

During the 20th century after the times of Mozart and the classical period, going to the ballet and opera was past time, and that majority of the wealthy and no-wealthy individuals enjoyed. In the year 1913, a dance and a music piece regarded as the rite of spring was introduced in Paris, to which is one of the controversial pieces of music to date. The music featured rhythms along with visuals to which no other of the musicians and composers had attempted. The thrilling ballet was a shock to many audiences as they had been used to the light and playful tone of the past century’s most famous Mozart. After the first minute of the piece, people had started leaving the theatre, by the middle people literary rioting in the streets. The ballet featured the aspects to which today are widely popular and considered classic, despite the widespread belief of the time that an opera that horrific and nonsensical would ruin the society through the weakening of the fundamental moral values of the audiences.

Socrates was a pillar of the society in the ancient Rome, challenging normality with his writings on philosophy and mathematics. In the present days, Socrates is looked upon as one of the greatest minds the race of humanity can offer, regarded as one of the fathers of philosophy, intellectualism and thought. It is unfortunate that Socrates was stoned to death in 399 BCE for corrupting the youths and ruining the society’s culture. The community would and can only be destroyed as long as the individuals in the society allow it to get ruined, and thus so far there has been no definition for a ruined society, but only change for the better or worse as humans tend to move forward and never back.

Reference

Neal, G. (1998). Life: The Movie, How Entertainment Conquered Reality.

Bioinformatics assignment: motif finding and transcription factor binding site prediction

Name____________________________________

The chart below is a position specific scoring matrix (PSSM, a logarithmic transformed matrix) for a transcription factor binding site. (1). Evaluate a sequence “GACATTCA” to find out which segment of the sequence fits the binding site best. (2) What is the max score that a sequence can have with this PSSM? (3) What is the minimum score a sequence can have with this PSSM?

There are many programs for transcription binding site prediction available free on the internet. Find a few of them, list the links to at least 2 websites. Test with the following sequence to see how it works and briefly describe your test results.

ATCAGGCCCCCAAGGAAGATTTGAAGGGGGCGACTGCATAGTCGGGGTAT

CTCCCATATACCCAAGGAGATGGGTTTCTCTAACAGCACCCACGTCAGTC

CTAAATCTTCTTACTCTCCTGGATTAGAAGACTGTGTTTCCCAGGCCACA

TCTGAGAAGCCTGAGCTCCTTAGCCCTGAAATAGCAGAGTGCTGACAAGA

CACAGGGGCCTAGGGGCTCTGGAGTCCAAGGGGAGTCCTCAGCAGAAGAC

ACATAGGAGGCATTCTTTGTTGGGGCTGGCTTTTCTGTTTGCAAAGCCTG

CTTGAAATATCCTGCCCTTTCTATGGACACTTTCCTTAGGATATAACCTA

ATCTGTGGTTAATCACTATTCTT

The following is the alignment of a putative transcription factor binding site from various genes.

Position 123456

AGAACC

ACAAAG

CGAGGA

TCAAGT

AACAGA

AGATGA

GGAAGA

AGTAGA

ATGCTA

AGTAGA

Based on the alignment, (1) generate a position specific scoring matrix (PSSM), and (2) show what DNA sequence could get the highest score (or the highest probability fitting the model, (3) indicate a DNA sequence that could be scored the lowest (fit with the lowest probability in this matrix (4) determine which substring in the sequence “AACCGTAAC” has the most likely binding site for this transcription factor if there is one, and what substring is the least likely binding site.

DNA motif search

DNA motifs are normally very subtle and can only be detected using “alignment-independent” methods such as expectation maximization (EM) and Gibbs motif sampling approaches.

a. Use the DNA sequence at the botton of the file and generate alignment using the EM-based program Improbizer (www.cse.ucsc.edu/~kent/improbizer/improbizer.html) with default parameters. Copy and paste your results to your report file.

b. Do the same search using a Gibbs sampling-based algorithm AlignAce (http://www1.spms.ntu.edu.sg/~chenxin/W-AlignACE/). Copy and paste the sequences below to the correct input box. Change the number in the box following the Number of Column to Align to 6, and change the value in the box following Number of Sites Expected to 3. Copy and paste your results to your report file.

c. Compare the results of best scored motifs from both methods. Are there overlaps?

d. Copy and paste the first motif derived from AlignAce to nedit. Remove the illegal characters (spaces and numbers).

e. Cut and paste the motif alignment into the WebLogo program

(http://weblogo.berkeley.edu/logo.cgi) Click the “Create logo” button. Copy your result by hold ctrl and print screen at the same time. Paste your result to your report file.

f. Does the program find the highlighted region in the sequence?

Modified by Xiaofei Wang, 2017

Updated 2020

>Seq1

CACATCCCACCACAACCTTCCAGCAGCACGTGCAGGAACAGACAGGGGAA

TGGACGTAAGCGGCTCCTTAATATAATGTTGGGTCGTCGTAGGGATACCT

AGAAAGGTGTCCTGATATTAACCAC

>Seq 2

GAGCTAACATCAAAGCAGCACGTTTCCTAACTAAGACTACACATTTTCCA

TCTCACGTGCACAACTGAGTCCCCACTAGGACACTTTACAGACATTTGGA

>Seq 3

AAAGTGATGATCCTTCCTTTCCCTCCTAGATTAAATACTCATGTCCCACG

TGTACATCAGACTCAGCGCTGCTCGTAGCTGGAAACAAGATGGTGAAACT

>Seq 4

AGATCTGAATAATGAAGTAAGTTGTTCCCTTACACATGCAGCAGAAACTG

CCATTGCCTTCAAGAGCTGCAGAATAACACACGTGTGCTGTTCTGCGGGG

>Seq 5

TCAAGACCACGTGAAAGGCCGAGGTGGGTGGATCACTTGAGGTCAGGAAT

CAGCCAGGCCAACACGGCAAAAGCCTGTCTCTACAAAAAATACAAAAAAT

TAGCAGGGGATGGTGGTGTGTGTCTGTAGTCCCAGCTATTGCAGTGAGCA

>Seq 6

CAAGCAGGCTTAAACAAAATTCAATATCTGGACACATTGTAGTTAAACCA

CGTGACACTGTTATCACTGTCACACACATCTGTGTGAAGAGACCACCAAA

ACCTAGTAGATCGTA

>Seq 7

TAGGCTTCATGTGAGCAATAAAGCTTTTTAATCACCTGGGTGCACGTGGG

CTGAGTCCAAAAAAGGAGTCAGCAAAGGGTGGTAGGATTATCATTAGTTC

TTGAGATCCGATCAAATGCTATCCCCGTTATHAY

>Seq8

CACACATACACACACCAGACACACACCACACGTGCATACACAGACACACA

CCACACGCACTCGCTCGCGCGCACACACACACACACTTTTTATATACAAA

>Seq 9

CCAAATTCAGAAAACATCACGTGGCTTTTTACAATGTTTTCAGCAGCATA

GAACTTTTGCTGCAATGTCGTCGTATATGTTCCCTAGGATATAGTCTCAATCT

TGGTATTGTAGCTGATAGTCTGTAAGGGTTTCCCCCAGTAACT